DSAP : Deep-sequencing Small RNA Analysis Pipeline

DSAP : Deep-sequencing Small RNA Analysis Pipeline

Loading
Loading Social Plug-ins...
Language: English
Save to myLibrary Post page as Slide Download PDF
Go to Page # Page of 49

Description: Prominent members of the RNA family, Formation and function of small RNAs, Discovery of miRNA, miRBase the microRNA database, Length distribution of mature miRNAs, Next Generation Sequencing Technology, Illumina SOLEXA sequencing by synthesis, Biogenesis of miRNA, How microRNA Works?, Roles of miRNAs, Functions of miRNA, miRExpress, miRTools, Trichomonas vaginalis, Phylogenic Distribution, Cross-species Distribution of Identified miRNAs, Phylogenic Distribution of Identified miRNAs.

 
Author: Banyan Kashiwa Kanoe long life assets Center (Fellow) | Visits: 1455 | Page Views: 1504
Domain:  Medicine Category: Biology Subcategory: Genomics 
Upload Date:
Short URL: http://medical.wesrch.com/pdfME162X718HUFK

Loading
Loading...



px *        px *

* Default width and height in pixels. Change it to your required dimensions.

 
Contents:
DSAP : Deep-sequencing Small RNA Analysis Pipeline


Prominent members of the RNA family

Nature 451, 414-416(24 January 2008)

Formation and function of small RNAs

Nature 451, 414-416(24 January 2008)

Discovery of miRNA y f

C. elegans

lin-4 (Lee R et al. 1993) let-7 (Reihhart et a . 2000 ) et 7 ( e a t al. 000

First miRNA - C. elegans lin-4 in 1993 by Victor Ambros & Lee linlin-4 causes temporal decreasing in LIN-14 protein expressed in the first larval stage (L1).
"The Caenorhabditis elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14". CELL (1993)

Victor Ambros

Second miRNA - C. elegans let-7 in 2000 by Frank Slack letmiRNA might be conservative in organic evolution and plays an important role in regulation of organic development.
"The 21-nucleotide l t 7 RNA regulates developmental timing i C "Th 21 l tid let-7 l t d l t l ti i in Caenorhabditis elegans" . NATURE h bditi l " (2000) Frank Slack

92 species 142species p 133 species 106 species 5 species

Length distribution of mature miRNAs

http://www.politigenomics.com/next-generation-sequencing-informatics

Next Generation Sequencing Technology
Illumina SOLEXA sequencing by synthesis

1) 3'Adaptor:
SRA,part#1000596

TCGTATGCCGTCTTCTGCTTG 21bp p ATCTCGTATGCCGTCTTCTGCTTG 24bp
v1.5,sRNA,part#15000263

------------------------------------2) 5' Adaptor: 5 GTTCAGAGTTCTACAGTCCGACGATC 26bp

Biogenesis of miRNA
Pri-miRNA: Primary miRNA, the whole transcript or miRNA gene. Usually several kilobases long; posses 5' cap and a poly-A tail. Drosha: RNAase III, processing pri-miRNA into premiRNA and leaving the 3' end with 2 nucleotides overhanging. Pre-miRNA: P P iRNA Precursor miRNA. Cl iRNA Cleaved in the d i th nucleus by Drocha enzyme to 70nt hairpin transcript Ran-GTP: Ran GTP: Exporting pre-miRNA from nucleus to pre miRNA cytoplasm.

Dicer: RNaseIII lopping the loop at loop and stem RNaseIII, junctin and still leaving the 3' end with 2 nucleotides overhanging. RISC: RNA-induced silencing complex, with the guiding of miRNA, RISC performing its downregulation ability by either mRNA degradation or translation inhibition.

How microRNA Works?
In cytoplasm, miRNA is loaded into an RNAinduced silencing complex (RISC) and binds to Argonaute (AGO) protein enzyme g ( ) p y present in the complex. Within the RISC the "sense" strand is degraded. g miRNA guides RISC to the target mRNA (complementary sequence). Target mRNA is degraded by the Argonaute enzyme. In mammalian cells, miRNA target sites are g located in the 3'-untranslated region (3' UTR) of target mRNA.

Roles of miRNAs

Stem cell division miRNAs and fin development

New class of small RNAs in worms

miRNAs host genes and transcription

miRNAs and immunity

Functions of miRNA

2008

2009

2009

2010

2010

2009 2009

miRExpress

deepDase

miRTools

11 species 15 species i

The miRNAWorld miRNA World
Viridiplantae Chlorophyta Chlamydomonas reinhardtii (49) Coniferophyta Pinus taeda (37) Embryophyta Physcomitrella patens (230) ( ) Selaginella moellendorffii (58) Magnoliophyta eudicotyledons Brassicaceae Arabidopsis thaliana (187) Brassica napus (44) Brassica oleracea (6) Brassica rapa (17) Caricaceae Carica papaya (1) Fabaceae Glycine max (78) Lotus japonicus (2) Medicago truncatula (38) Vigna unguiculata (1) Malvaceae Gossypium herbecium (1) Gossypium hirsutum (13) Gossypium rammindii (2) Salicaceae Populus trichocarpa (234) Solanaceae Solanum lycopersicum (30) Vitaceae Vitis vinifera (140) ( ) monocotyledons Oryza sativa (377) Saccharum officinarum (16) Sorghum bicolor (72) Triticum aestivum (32) Zea mays (98) Arthropoda Crustacea Daphnia pulex (43) Chelicerata Ixodes scapularis (34) Hexapoda Anopheles gambiae (67) ( ) Acyrthosiphon pisum (10) Aedes aegypti (102) Apis mellifera (64) Bombyx mori (487) Drosophila ananassae (76) Drosophila erecta (81) Drosophila grimshawi (82) Drosophila melanogaster (171) Drosophila mojavensis (71) Drosophila persimilis (75) Drosophila pseudoobscura (211) Drosophila sechellia (78) Drosophila simulans (136) Drosophila virilis (74) Drosophila willistoni (77) Drosophila yakuba (80) Locusta migratoria (7) Tribolium castaneum (55) Cephalochordata Branchiostoma floridae (77) Urochordata Ciona intestinalis (332) Ciona savignyi (27) Oikopleura dioica (66) Amphibia Xenopus laevis (23) Xenopus tropicalis (186) Aves Gallus gallus (499) Taeniopygia guttata (220) Carnivora Canis familiaris (325) Metatheria Monodelphis domestica (157) Primates Atelidae Ateles geoffroyi (60) Lagothrix lagotricha (48) Cebidae Saguinus labiatus (42) Cercopithecidae Macaca mulatta (485) Macaca nemestrina (75) Pygathrix bieti (11) Hominidae Gorilla gorilla (86) Homo sapiens (706) Pan paniscus (89) Pan troglodytes (594) Pongo pygmaeus (84) Symphalangus syndactylus (11) Lemuridae Lemur catta (16) Prototheria Ornithorhynchus anatinus (331) Rodentia Cricetulus griseus (1) Mus musculus (547) Rattus norvegicus (286) Ruminantia Bos taurus (356) Ovis aries (4) Suina Sus scrofa (77) Pisces Danio rerio (336) ( ) Fugu rubripes (131) Tetraodon nigroviridis (132) Echinodermata Strongylocentrotus purpuratus (45) Hemichordata Saccoglossus kowalevskii (43)

miRNA count: 15172 entries
Release 16.0 (Sep 2010)
Nematoda Caenorhabditis briggsae (95) Caenorhabditis elegans (155) Platyhelminthes Schistosoma japonicum (5) Schistosoma mansoni (5) Schmidtea mediterranea (63) ( ) Lophotrochozoa Annelida Capitella sp. I (71) Molusca Haliotis rufescens (5) Lottia gigantea (59) Nemertea Cerebratulus lacteus (2) Cnidaria Hydra magnipapillata (1) Nematostella vectensis (40) Porifera Amphimedon queenslandica (8) Mycetozoa Dictyostelium discoideum (2) Viruses BK polyomavirus (1) Epstein Barr virus (25) Herpes Simplex Virus 1 (6) Herpes Simplex Virus 2 (3) Human cytomegalovirus (11) Human immunodeficiency virus 1 (3) JC polyomavirus (1) Kaposi sarcoma-associated herpesvirus (13) Mareks di M k disease virus (14) i Mareks disease virus type 2 (17) Merkel cell polyomavirus (1) Mouse cytomegalovirus (18) Mouse gammaherpesvirus 68 (9) Rhesus lymphocryptovirus (16) Rhesus monkey rhadinovirus (7) Simian virus 40 (1)

142 species ( p (miRBase v16) )

Trichomonas vaginalis

Phylogenic Distribution

tv-miRtv-miR-1
group 1
related fold

g group 2
14 12 10 8 6 4

the stem-loop real time PCR to identify the precise sequence

2 0

group_1

group_2





DSAP: deep-sequencing small RNA analysis pipeline deepNucleic Acids Res. 2010 July 1; 38(Web Server issue):W385�W391.

http://dsap.cgu.edu.tw

Implementation
DSAP runs on a Linux CentOS 64-bit server housing two d t quad-core I t l� X � 5300 S i Processors and Intel� Xeon� Series P d 16 GB RAM.

Workflow
Clean up Cl g Clustering ncRNA matching(Rfam V9.1: 192445 seqs v10 : 444417seqs) Known miRNA matching t hi p Comparative miRNAomics

DSAP data input page

DSAP Functions

Number of reads: 38,346,007 Number of Tags: 9,783,514
JOB ID:1234567890

NonNon-Coding RNAs Searching

miRNAs Searching

IsoIso-miR

CrossCross-species Distribution of Identified miRNAs

CrossCross-species Distribution of Identified miRNAs

Phylogenic Distribution of Identified miRNAs

Comparative miRNAomics

non-normalized

normalized

Comparative miRNAomics

Comparative miRNAomics by mature miRNA

Comparative miRNAomics by miRNA family

normalized

DSAP2
Map2Genome

Novel miRNA prediction

isomiR & miRNA editing
>hsa-let-7a-1 TGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACTGGGAGATAACTATACAATCTACTGTCTTTCCTA (((((.(((..((((((((((((((((...(((.....))).((....))....))))))))))))))))..)))))))) TGAGGTAGTAGGTTGTATAGTT *****TGAGGTAGTAGGTTGTATAGTT***************************************************** ********************************************************CTATACAATCTACTGTCTTTC*** ..GGATGAGGTAGTAGGTTGTATAG....................................................... ....ATGAGGTAGTAGGTTGTATAGTT..................................................... ....ATGAGGTAGTAGGTTGTATAGT...................................................... ....ATGAGGTAGTAGGTTGTATAG....................................................... ....ATGAGGTAGTAGGTTGTATAGTTT.................................................... .....TGAGGTAGTAGGTTGTATAGTT..................................................... .....TGAGGTAGTAGGTTGTATAGT...................................................... .....TGAGGTAGTAGGTTGTATAGTTT.................................................... .....TGAGGTAGTAGGTTGTATAG....................................................... hsa-let-7a-1 structure hsa let 7a hsa-let-7a hsa-let-7a* t0227878 t0006845 t0021457 t0039011 t0165920 t0000002 t0000015 t0000044 t0000082 80 -35.6 22 21 23 23 22 21 24 22 21 23 20 1 42 9 4 1 1043926 96011 36942 13528 isomiRs 5' -3 -1 -1 -1 -1 0 0 0 0 3' -2 0 -1 -2 1 0 -1 1 -2

Differential Expression

Novel miRNA Prediction
Soap2genome RNAfold Filter Vienna

Trichomonas Vaginalis
TvE-m0002 Trichomonas_vaginalis_G3|DS113908|2007-01-11|ds-DNA|Trichomonas_vaginalis_Carlton:29154:29248:- 95(nt) -22.00(kcal/mol) AAATTTGTAAGGGGTGAATGGTATAATGGTTAGTATTGTTGATTGTGGCTCAATAGATCTGTGTTCGATTCACGGTTCACCCACTTTTTTATTTT TvE-m0002 337985 TvE m0002 ((((....(((((((((((.((..(((.(.(((..(((((((.......)))))))..)))....).))).)).)))))))).)))....)))). **********GGGGTGAATGGTATAATGGTTA*************************************************************** TvE-m0002-5p 337865 *************************************************************TGTTCGATTCACGGTTCACCCACTT********* TvE-m0002-3p 29 ------GTAAGGGGTGAATGGTATAATGGTT---------------------------------------------------------------- Cluster_116016 1 --------AAGGGGTGAATGGTATAATGGTTA--------------------------------------------------------------- Cluster_2927 22 --------AAGGGGTGAATGGTATAATGGTTAG-------------------------------------------------------------- Cluster_2928 8 ---------AGGGGTGAATGGTATAATGGTTA--------------------------------------------------------------- Cluster_14163 4 ---------AGGGGTGAATGGTATAATGGTTAG-------------------------------------------------------------- Cluster_14164 2 ---------AGGGGTGAATGGTATAATGGTTAGT------------------------------------------------------------- Cluster_14165 1 ----------GGGGTGAATGGTATAATG------------------------------------------------------------------- Cluster_102092 447 ----------GGGGTGAATGGTATAATGG------------------------------------------------------------------ Cluster_102117 1093 ----------GGGGTGAATGGTATAATGGT----------------------------------------------------------------- Cluster_102195 1483 GGGGTGAATGGTATAATGGTT Cluster_102237 ----------GGGGTGAATGGTATAATGGTT---------------------------------------------------------------- Cluster 102237 2981 ----------GGGGTGAATGGTATAATGGTTA--------------------------------------------------------------- Cluster_102238 192067 ----------GGGGTGAATGGTATAATGGTTAG-------------------------------------------------------------- Cluster_102269 91570 ----------GGGGTGAATGGTATAATGGTTAGT------------------------------------------------------------- Cluster_102342 9375 ----------GGGGTGAATGGTATAATGGTTAGTA------------------------------------------------------------ Cluster_102343 18014 ----------GGGGTGAATGGTATAATGGTTAGTAT----------------------------------------------------------- Cluster_102368 9145 -----------GGGTGAATGGTATAATGG------------------------------------------------------------------ Cluster_107222 36 -----------GGGTGAATGGTATAATGGT----------------------------------------------------------------- Cluster_107235 59

IsomiRs & miRNA Editing

Differential Expression
DSAP2 (Clickable Version)

miRTools

No Limit

DSAP2
P
Subscribe
x